Loading

BLAST - Exercise #1 - Advanced

You are studying ribosomes and protein synthesis.  The postdoc you are working asks you to identify which ribosomal protein is encoded by the nucleotide sequence below. Use your bioinformatics skills to help her out.

  1. Use the EMBL-EBI web based sequence tool to translate the sequence  (http://www.ebi.ac.uk/Tools/emboss/transeq/index.html) and find the ORF in the correct reading frame (you must select “6” under the frames pull down menu before translating to see all 6 frames).  Report the correct reading frame (+3, +2, +1, -1, -2, or -3).  You can assume the first methionine in the correct reading frame is the start methionine.
  2. GAGGAAGAGATGGAAACTATCGCTAAACATCGCCATGCTCGTTCTTCTGCTCAGAAGGTTCGCCTTGTTGCTGACCTGATTCGCGGTAAGAAAGTGTCGCAGGCTCTGGATATTTTGACCTACACCAACAAGAAAGCGGCTGTACTGGTCAAGAAAGTTCTGGAATCTGCCATTGCTAACGCTGAACACAACGATGGCGCTGACATTGACGATCTGAAAGTTACGAAAATTTTCGTAGACGAAGGCCCGAGCATGAAGCGCATTATGCCGCGTGCAAAAGGTCGTGCAGATCGCATCCTGAAGCGCACCAGCCACATCACTGTGGTTGTGTCCGATCGCTGAGACTCTGGAG

     

  3. Use the EcoCyc BLASTp function (using the correct protein sequence from part a) to determine the protein name and function(s) of this sequence.
  4.  

  5. Record the Score, E-value and % Identity of the top hit.
  6.  

  7. How does BLASTp differ from BLASTx? 
  8.  

  9. Is the gene encoding this protein found in an operon?  If yes, name the other genes that make up the operon.
  10.  

  11. You are curious to compare the amino acid sequence of L22 from E. coli (sequence from part b) to orthologs found in a Gram-positive organism, Bacillus subtilis subtilis 168, and the sister group to E.coli, Shigella flexneri 2002017.  Use BLASTp and record the name of the top hit and its Score, E-value, and % Identity for each bacterium separately (do not forget to “Change Organism Database” before repeating this BLASTp).  Based on the BLASTp statistics, which one is a better hit, or are they comparable?  Why?
  12.